Human Variation and Race Blog

1. High altitude can negatively impact the survival of humans by disturbing homeostasis. The saturation of hemoglobin with oxygen regulates the amount of oxygen in our blood. The higher the altitude, the lower oxyhemoglobin which then makes it harder to breath. This is why it is very hard for humans to adapt to this type of environment. After the human body reaches the height of 7,000 feet above sea level, the saturation of oxyhemoglobin begins to drop. Our bodies developed to have a long-term and short-term adaptation to altitude, which allows the body to moderately balance itself for the lack of oxygen. Although, our body can adapt to the altitude change, the limit our body can take is 26,000 feet.

2. 4 ways in which humans have adapted to stress:

A. Developmental Adaption- This adaption is usually done by athletes who try to train their breathing. Many humans utilize diets, exercises, or tools to help themselves adapt to these high altitudes. To develop the adaptations for high altitude many go on certain diets. For example, people consume large amounts of water to keep one’s skin replenished. As for athletes, they usually exercise at higher altitudes to constantly make more oxyhemoglobin, which allows our bodies to breath more easily in lower altitudes. The different tools used to develop an adaptation can be oxygen tanks. These are usually for higher levels of altitude such as mountain hiking.

B. Cultural Adaption- The cultural adaptations consist of civilizations that developed a higher oxyhemoglobin because of the are they reside. They develop adaptations in their DNA in order to handle the high altitude. This is an example of natural selection. The concept of natural selection is a huge aspect that guides a population to become genetically suitable for low and high elevations. For example, cultures that reside in mountains are adapted to high altitudes just like how those that reside in lower altitude areas have lower levels of oxyhemoglobin, which makes it harder to breath on a mountain.

C. Short Term Adaption- If one is not yet adapted to high altitudes and they immediately sense high altitudes, short term adaptation occurs. The idea of short term adaptation is that our bodies sense high doses of oxygen in a short amount of time in which there will be an increase in the breathing rate which is also known as hyperventilation.

D. Facultative adaption- A facultative adaption to high altitude is the increase in the body’s red blood cell count. When our bodies reach a high altitude, the red blood cells increase in order to carry oxygen more efficiently throughout the body. Not only does the red blood cells increase but our lungs also increase in size to transfer oxygen and carbon dioxide at a more consistent and faster rate.

3. There are many various benefits of understanding our body development due to high altitude. These include how our bodies carry various amount of oxyhemoglobin and how the amount changes to match the altitude in which our bodies are handling. It is good to know the proper ways to adapt to these intense situations whilst understanding what happens to our bodies. For example, it is beneficial to know the proper exercises needed to be done to go on a mountain hike in order to regulate breathing.

4. I believe that you cannot use race to understand the variation of adaptions listed in number two. The main reason I don’t believe this is because race is just our physical appearance such as skin color, eye color, hair color, bone structure, etc. Race does not have a direct connection with the way our bodies adapt to high altitudes. The study of environmental influences on adaptation is a better way to understand human variation rather than race. This is because environmental influences on adaptations describe the setting they are placed in which makes a big influence with how our bodies react to altitudes. This way it is determined by our exposure with certain altitudes rather than how we look. I feel like a better question to ask is “How would you use Ethnicity …” because ethnicity at least relates to cultural factors and these cultural factors may include ancestors that can handle high altitudes.

Language

Part 1:

I found this part of the experiment pretty easy while not communicating with words or ASL. As for my partner, they were able to express their points across more because I was not interrupting them in the middle of their sentences. I was still able to agree and disagree with them by either nodding or giving them a disapproving expression on my face. Throughout the conversation their tone tends not to change, because of the passion they have with whatever they wanted to talk about. As for the interaction of two different cultures meeting for the first time, it is assumed that the culture that is speaking would be the one communicating complex ideas. The attitudes that the speaking culture might have may go two ways: they may be passionate about what point they are trying to get across or they may be annoyed that the other culture isn’t expressing their ideas about the topic. Individuals in our culture that have difficulty communicating with spoken language is deaf people. When speaking with a deaf person, it may change the way those who speak with them because they obviously cannot hear what they are saying. People usually tend to speak slower so that the deaf person can make out what words they are saying by reading their lips.

Part 2:

To be completely honest, I was not able to last 15 minutes of only using speech for communicating. I feel like there was no emotion in my words, so I felt like my partner could not fully understand what I was saying. Because I felt like they couldn’t understand, I had to keep repeating myself but in different words. Every single time, I felt unsatisfied by the way I was speaking to them. My partner’s reaction toward this experiment was very confused and/or bored, as if they did not want to listen to what I had to say. They were very uninterested in the topic I was talking about. This shows that “signs” in our language is very important in able to properly express our point. Most would not take anyone seriously if there were no “signs” in their language. There are people who have difficulty reading body language. For one, blind people cannot even see the body language that is being expressed, so they obviously have difficulty in this. The adaptive benefit to possessing the ability to read body language is that they can understand what a person is feeling just by understanding certain body movements. Understanding one’s feelings before speaking with them can be beneficial in many ways between courting someone to interviewing for a job. Unfortunately, I cannot think of a scenario where it is beneficial to not read body language, because body language is what determines the attitude and mood of others.

Piltdown Hoax

The Piltdown Hoax was a discovery of bone fragments (skull and jawbone) that represented remains of an undiscovered early human. The discoverer of the Piltdown Man was Charles Dawson, a British Archeologist. He made this discovery East of Sussex England in a gravel pit, during the year of 1912. Throughout the time of the discovery, Dawson was praised, for it was the “missing link” between humans and primates. This provided scientists and anthropologists, such as Arthur Keith, proof of his theory about human evolution. For the next decade, the Piltdown fossil was the backbone for all of the research regarding evolution of humans. By 1920s scientists discovered ancient remains in Asia and Africa. The new fossils were known to be hundreds and thousands of years after the Piltdown man. And those skulls were less like a human rather than Piltdown man’s more humanly structure. This is how they theorized that Piltdown was a fraud. Later, as technology advanced, they were able to discover that the Piltdown teeth and skull were shaven down so some parts would look more human. They then realized it was just remains of a female ape that was formed to look like human.

Human faults played a significant role in the process of discovering the evolution of man. These faults consist of not testing and properly analyzing what they are being handed. They should have known that fossils are easy to tamper with and scientists should have checked their research rather than being excited about a discovery. A human fault of theirs was that they didn’t have more proof. If they wanted to see if the Piltdown man was real, why didn’t they go out to the same area where Dawson found it and continue to find more for more research? Instead they were excited to find the “missing piece” that they were careless which risked them decades of faulty information.

Scientists then started to use scientific processes that proved the skull to be fraud. By measuring the fluorine content of fossils, scientists can roughly date them. And according to video number 2, in 1949 scientists conducted this test on the Piltdown fossil and it showed that the fossils were only a couple hundred thousand years old. Being the shape that it is, those fossils would have to be millions of years old. In 1953, scientists developed better dating methods and all the stains were superficial. Each cut seemed as if it were cut by a steel knife and lastly the teeth were filed down to a desired shape.

I believe removing the “human” factor in science will not do anything. Science is always changing and there is always going to be errors within the practice. If anything, I would remove the pride of the work. Every scientist wants to be the one that discovers something new and something that changes the world. Without this pride, science would leap in far better directions because it gets rid of the competition aspect. Usually the competition aspect may make science better because scientists are motivated by it, but like the Piltdown case, scientists may be held back decades of research. This precious time may have been used for more modern research and our generation could have evolved to better species in that time wasted.

The life lesson that I got from this is not to believe everything that people say is true without the proper research. It is easy to believe a lie, but after living your whole entire life believing that lie, it is hard to go back and believe the truth. Before believing something, it is best to do your own research and look up proper sources rather than believing one opinion or one statement.

Locomotor Patterns of Primates

Lemurs

A. Lemurs live on the island Madagascar. Madagascar's terrain varies from beautiful coastal beaches and stretches of serene grassland to raging rivers winding through mountainous regions and dry expanses ­of desert.

B. Lemurs are primarily known for their ability to leap from tree to tree. 

C. Because of Madagascar's environment, lemur's do not usually live in trees nor the land because of the poor soil. Also, because of the poor soil, food for the lemurs is usually found on trees. This allowed lemurs to adapt to their environment and gave them the ability to climb trees for food. Lemurs are also vulnerable to most predators so they developed the ability to leap from tree to tree in order to avoid certain demise. 

Spider Monkeys

A. Spider Monkeys live primarily in rain forest habitats usually in Central and South America. 

B. The spider monkey's locomotor pattern consists of quadrupedal, suspensory, or bipedalism. Quadrupedal is the the idea of the primate using all four limbs to travel, suspensory is the idea of the monkey hanging, gliding, or climbing through trees, and bipedalism is the concept of using two limbs while leaping. 

C. Since spider monkeys are in a habitat with mostly trees, they developed certain physical traits to allow them to move around their environment. Their tail is designed to balance the monkey while swinging from tree to tree. 

Baboon

A. Baboon's live primarily in Africa or Arabia. Baboons generally prefer savanna and other semi-arid habitats, though a few live in tropical forests.

B. Baboons locomotor pattern is walking quadrupedally, meaning on all fours. Because they are semi-terrestrial they stay on the ground during the day but also climb trees to sleep at night. Baboons do not have prehensile tails because it is not needed as much as other primates.

C. The baboon's locomotor patterns are what they are because of the environment. Since they do not usually climb trees, there is no need for a tail like most monkeys. The extra limb would be wasted because the monkey tends to always stay on the ground. 

Gibbon

A. They are primarily found in the tropical and subtropical rain-forests of the South, East and Southeast Asia. Gibbons spend most of their lives in trees.

B. Gibbon's locomotor patterns consist of brachiating, in which they travel from tree to tree by swinging on the branches. There are some times they walk with it's two limbs, but their primary way of traveling is by swinging. 

C. The environment that the gibbons are placed in influenced the gibbons in which they developed long arms to swing from tree to tree. This let's the primate travel faster and escape from any dangers that threaten it. This ability makes the gibbon almost impossible to catch. 

Chimpanzee

A. Chimpanzees are mainly found in grasslands, African rain-forests, and woodlands. 

B. The chimpanzee's locomotor pattern consists of walking quadrupedally. Chimpanzee's are one of the few primates, along with gorillas, that walk on with their fists. They also carry the ability to swing from between trees to gather food. 

C. The chimpanzee's locomotor trait is crucial to it's environment. Between gathering food and and swinging on tree's, the chimpanzee is constantly adapting to it's environment. 

I believe that the environment plays a significant role in the physical and behavioral traits of every primate. Each primate that I studied had a special trait that was influenced by their environment. Being physically adaptive to their habitat, I saw that they are also behavioral and emotionally adapted to their environment. While some primates have physical features to help them survive such as long arms, others have an extended tail for benefits of their environment. I learned that environments play a really big significant role to primates locomotor patterns.

Homology and Analogy

1. Homologous

Two different species that carry the same trait is a Humming Bird and an Eagle. Hummingbirds are birds that make up part of the Trochilidae family. They are among one of the smallest birds ranging from only 7.5-13cm long. The Eagle on the other hand is a much bigger and more powerful bird that belongs to the Accipitridae family. Their size starts at 40cm long and increases according to each certain species. The trait that Hummingbirds and Eagles share is the structure of their wings—they both possess the same skeletal structure in their wings. Their digits are stacked on one another to support their wings; in addition, they also have an ulna, radius, and humerus as a part of their skeletal structure. This homologous trait plays a different role in the lives of both hummingbirds and eagles. Hummingbirds’ skeletal structure allows for faster movements as they hold the ability to flap their wings 12-80 times per second. Not only can they fly fast (25 to 20 miles per hour), the wings of a hummingbird gives it the abilities to fly forward, backward, hover, and upside-down for a short amount of time. Hummingbirds do not flap their wings when they fly (only when they hover), they rotate it in an oval pattern thanks to the ball and socket joint in their shoulder.  As for the eagle, their skeletal structure is more hallow so that they have the ability to glide without the need to constantly move their wings (this provides the eagle with more velocity rather than wing speed). The shape and size of an eagle’s wings work with the air current to help the eagle keep its high altitude. In addition, eagles have wing slots which are finger like gaps between their large and primary feathers that help them with stability and maneuvering as they fly. The common ancestor for the hummingbirds and eagles can be traced as far back as the birds of the Jurassic period. These birds are categorized as Aves; both the Humming bird and the Eagle contain structures similar to the Jurassic Aves. 

2. Analogous

Two different species that posses an analogous trait are apes and pandas. Apes belong to the Hominoidea family and are considered Old World anthropoid mammals. They are native to Africa and countries in South-east Asia. Pandas on the other hand are native to only south central China, but there have been an increased effort to breed pandas (especially in zoos) in other locations such as North America and Europe. Their diet is 99% bamboo but when circumstances require it, they will eat meat. The trait both apes and pandas share is the possession of opposable thumbs. The skeletal structure of the both the ape and the pandas hands consist of similar bones that make up an opposable thumb. Pandas have six phalanges instead of five like an ape. The panda has five normal phalanges along with a “thumb” called a False Thumb. This thumb is the panda’s opposable thumb that makes it possible for pandas to hold bamboos to eat. . Pandas on the other hand come from the bear family. Pandas developed their “false thumb” due to the need to eat (and their specific diet of bamboo) to ensure survival. Because they mainly eat bamboo, it was significant and crucial that they developed opposable thumbs to grab the bamboo and break it off which increased their chances of survival. Taking a look back into the ancestry of apes tells us that they had always possessed opposable thumbs. This trait developed due to the environmental demands and the need to survive. Apes need their opposable thumbs to climb trees and grasp vines and braches so that they are able to swing from one tree to the next. This is their way of surviving and hiding from their preys on the grounds—their survival is dependent on the possession of opposable thumbs. Opposable thumbs developed in both apes and pandas to help them survive. Both use their opposable thumbs to extract food to decrease their risk of starvation; this trait gradually appeared in both animals due to harsh environmental conditions that threaten to kill those who do not adapt. 

DNA Decoding

ACGTATACACCCTTTGGGCTAGGATTTCAAGTGTCACCTTGTCTATCTAACG

Jean Baptiste Lamarck: Evolutionist

Jean Baptiste Lamark is one of the earliest scientists to impart his beliefs and ideas on evolution to the public. He proposed the idea that organisms evolve from simple to complex forms; by this, Lamark means that any organism starts its life in the most simple and basic form and gradually evolve in an upward direction towards a more complex form. This “complex form” refers to an organism that resembles perfection for it is the best evolved form of its species. According to Lamark, evolution happens over time as organisms change their behavior to match environmental changes; this changed behavior modifies their organs causing their offspring to inherit these “improved” structures. One example lays in the reasons for giraffes long necks—using Lamark’s theory, these giraffes’ long necks are due to generations of browsing in tree leaves. Because they spend all their time stretching their necks to reach the tree leaves, their organs and muscles “adapt” and alter to better compromise their situation. This does not occur instantaneously but rather over generations. (Information obtained from: http://www.pbs.org/wgbh/evolution/library/02/3/l_023_01.html)

               “If the environment changes, the traits 

               that are helpful or adaptive to that environment will be different.”

This quote simply states the most basic idea of Darwinism: natural selection—which is nature choosing which organisms will survive and achieve reproduction. Jean Baptiste Lamark influenced this idea when he stated that organisms change their behaviors to match environmental changes. In a sense, Darwin’s natural selection is a backwards repetition of Lamark’s theory. Lamark believed that organisms incur the change themselves while it could be said Darwin bettered the theory by claiming that nature itself is the one that inflicts alterations in a species over time. According to the quotes, “traits that are helpful or adaptive to [the] environment” evolve in accordance with environmental changes. This is the exact idea Lamark was trying to portray with his theory of organisms’ organs restructuring to match environmental changes. Of course organs are not exactly the same as traits but Lamark was correct in his hypothesis that changes in a species occur due to changes in the environment.  

It is in my opinion that Charles Darwin could not have developed his theory of evolution without the influence and ideas of Jean Baptiste Lamark. Lamark caved the way for Darwin with his realization that the environment plays a big part in the evolution of species throughout generations. Lamark’s intensive research and data collection played a big part in helping Darwin shape his theory of evolution; Lamark had already done the research, Darwin simply analyzed and added on to it. According to Berkeley (in their link: http://www.ucmp.berkeley.edu/history/lamarck.html), they state that “[Darwin] later admitted that the heritable effects of use and disuse might be important in evolution.” From this, it is clear to see that Lamark was one of the resources Darwin used to develop his natural selection theory.  

Back in the days of Charles Darwin (1800s), the church was the prevailing power in the land. Its idea of human creation was expected to be accepted by all; those who dared to challenge this idea risk hypocrisy and being attacked by the church. This became the biggest conflict for Darwin who grew up as a devoted follower and member of the church itself—he was greatly involved in the church’s activities and even attempted to become a clergyman himself. Because of this, Darwin remained unsure of whether or not he should publish his book On the Origin of the Species. Not only did the church’s ideas affect his publication, but it also affected the book’s content—Darwin tried to stay away from discussing human evolution in his book due to the prejudices of the church. Eventually, Darwin published his work with the encouragement, support, and urges of his scientific friends.